Counterion raises a handful of sensible questions. This page answers them in order, starting with the fundamentals and moving to applications.
Reviewed 2026-02-17. Anything still debated is marked as such rather than presented as settled.
After a peptide solution is prepared, its handling conditions influence how long it remains suitable for use. Solutions are typically separated into small portions to avoid repeated freeze-thaw cycles, which can promote aggregation or precipitation. Containers are chosen to minimize adsorption, especially for peptides that are hydrophobic or present at low concentration. Some laboratories use low-binding plastic tubes or add a carrier protein, although carrier addition can interfere with later analysis. Records usually note the solvent, date, and storage temperature for traceability.
Storage stability of a reconstituted peptide depends on concentration, pH, buffer composition, and the presence of oxygen or microbial contaminants. Short-term storage is often at refrigerated temperatures, while longer-term storage may use freezing at -20 °C or -80 °C. Repeated warming and cooling can cause losses through adsorption or aggregation, so aliquots are preferred. Light-sensitive peptides require protection from ambient light. Sterile filtration may be used when microbial control is needed, but filters can adsorb peptides and reduce recovery.
Peptide reconstitution refers to dissolving a dried peptide preparation in a liquid to form a solution. The dried form is often produced by lyophilization, a process that removes water under vacuum from a frozen sample. This yields a porous cake or powder that is more stable for transport and storage than many liquid formulations. The term reconstitution is also often used for other dried biological materials, so context matters greatly.
The choice of liquid depends on peptide sequence, counterion content, and intended analysis. Water is sufficient for many hydrophilic peptides, while hydrophobic sequences may need a small amount of organic solvent or a buffer. pH can affect charge, solubility, and stability, so the target value is usually selected for the specific peptide. Exact laboratory protocols vary by supplier and application, and no single solvent reliably works for every different peptide.
| Property | Value | Notes |
|---|---|---|
| Appearance | Clear to slightly opalescent | Opalescence may indicate aggregation or undissolved material |
| Typical pH range | 3–7 for many peptides | Depends on sequence and buffer; measured after dissolution |
| Storage temperature (short term) | 2–8 °C | Refrigerated; limit repeated warming |
| Storage temperature (long term) | -20 °C or -80 °C | Freezing recommended for many research peptides |
| Common analytical method | RP-HPLC with UV detection | Purity and degradation profile can be monitored |
Peptide reconstitution is the process of dissolving a lyophilized peptide powder in a liquid solvent to produce a solution of defined concentration. Lyophilization removes water under vacuum from a frozen peptide solution, leaving a porous cake or powder. The dry form is often more stable for shipping and storage. Reconstitution restores the peptide to a liquid state for analytical, biochemical, or formulation work. The exact solvent depends on peptide sequence and intended assay.
Water is common, but not universal; hydrophobic peptides may require organic co-solvents like acetonitrile or dimethyl sulfoxide. Acidic peptides may dissolve better in dilute acetic acid or ammonium hydroxide, while basic peptides may favor slightly acidic conditions. Buffer choice matters because pH can affect charge, solubility, and aggregation. Some peptides require sonication or gentle mixing, whereas vigorous vortexing can cause foaming and surface denaturation. The target concentration is typically calculated from the labeled peptide mass and the volume of solvent added.
Once a peptide is dissolved, water becomes a medium for hydrolysis, oxidation, and deamidation. Dry powders often tolerate ambient shipping better than liquid solutions, but the exact stability profile depends on sequence and formulation. Refrigerated storage near 2 to 8 degrees Celsius or frozen storage at minus 20 or minus 80 degrees Celsius is common in laboratories. Repeated freeze-thaw cycles can promote aggregation, precipitation, or loss of activity. Dividing a solution into single-use aliquots before freezing can reduce the number of temperature cycles.
Aseptic technique is used when a reconstituted solution must remain free of microbial contamination. Work surfaces, gloves, and instruments are cleaned, and the septum of a vial is disinfected before solvent is added. A venting needle or pressure equalization can prevent aerosol formation and pressure buildup. Bacteriostatic water contains an antimicrobial preservative, but preservatives can interfere with some assays or alter peptide behavior. Sterile filtration may be used when a formulation cannot be heat sterilized or when particulates must be removed.
Lithium is a teratogen, which can cause birth defects in a small number of newborns. Case reports and several retrospective studies have demonstrated possible increases in the rate of a congenital heart defects (CHDs) including Ebstein's anomaly if taken during the first trimester of pregnancy. The risk is dose-dependent: in the 2017 AMX registry study, the relative risk of "any malformations" is 1.11 in those taking no more than 600 mg of lithium carbonate daily, 1.60 in those taking 601–900 mg daily, and 3.22 in those taking more than 900 mg daily. The first two numbers do not indicate a statistically significant association. In a 2018 meta-analysis, there was a statistically significant 62% increase (95% CI: 12%–133%) in congenital malformations in general, but not for cardiac malformations specifically. Exposure during any part of the pregnancy is associated with a slight but statistically significant increase in the risks of preterm birth and of a larger-than-usual baby at birth. Lithium is effective for preventing relapse during and after pregnancy. As the risks of stopping Lithium can be significant, patients are sometimes recommended to stay on this medicine while pregnant. Careful weighing of the risks and benefits should be made in consultation with a psychiatric physician. The relatively low teratogenic risk of lithium allows such a choice. The decision should be made before the start of pregnancy, as there is no reason for stopping lithium once the pregnancy has started.
– vasevine, traveller's joy Clematis virginiana L. – devil's darning needles, Virginia bower Clematis viridiflora Bertol. Clematis vitalba L. – traveller's joy, old man's beard Clematis viticaulis E.Steele – Millboro leather flower Clematis viticella L. – Italian leather flower, purple clematis
== Criticism == Numerous critiques have been made regarding the use of impact factors, both in terms of their statistical validity and also of their implications for how science is carried out and assessed. A 2007 study noted that the most fundamental flaw is that impact factors present the mean of data that are not normally distributed, and suggested that it would be more appropriate to present the median of these data. There is also a more general debate on the validity of the impact factor as a measure of journal importance and the effect of policies that editors may adopt to boost their impact factor (perhaps to the detriment of readers and writers). Other criticism focuses on the effect of the impact factor on the behavior of scholars, editors and other stakeholders. Criticism of impact factors also extends to its impact on researcher behavior. While the emphasis on high-impact journals may lead to strategic publishing practices that prioritize journal prestige over the quality and relevance of research, it's important to acknowledge the "privilege paradox". Younger researchers, particularly those from under-represented regions, often lack the established reputation or networks to secure recognition outside of these metrics. This can lead to a narrow focus on publishing in top-tier journals, potentially compromising the diversity of research topics and methodologies. Further criticisms argue that emphasis on impact factor results from the negative influence of neoliberal politics on academia.
Sources: en.wikipedia.org
=== Reduced NMDA‐receptor function === Reduced NMDA receptor function has been linked to reduced social interactions, locomotor hyperactivity, self-injury, prepulse inhibition (PPI) deficits, and sensory hypersensitivity, among others. Results suggest that NMDA dysregulation could contribute to core ASD symptoms.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
On what would've been Staley's 50th birthday, August 22, 2017, Alice in Chains released a video paying tribute to him, featuring Jerry Cantrell, Ann Wilson, Mike McCready, and Barrett Martin. William DuVall revealed that he was thinking about Staley, his grandmother and the Soundgarden lead vocalist Chris Cornell while writing the Alice in Chains' song "Never Fade", from their 2018 album, Rainier Fog. The album's title track, written by Cantrell, is partly a tribute to Staley and Mike Starr. The Mountain Goats opened their 2026 album Days with "Song for Layne Staley."
Sources: en.wikipedia.org
Additionally, PELs lack the inherent amplification capabilities of DELs and rely on current mass spectrometric analysis for decoding. Since peptide decoding requires complex mass spectrometry and computational power, this means that current detection sensitivity limits practical PEL sizes.
=== Regulation === PCP is a Schedule II substance in the US. The Administrative Controlled Substances Code Number (ACSCN) for PCP is 7471. Its manufacturing quota for 2014 was 19 grams (0.67 oz). It is a Schedule I drug by the Controlled Drugs and Substances act in Canada, a List I drug of the Opium Law in the Netherlands, and a Class A substance in the UK.
== History == It was approved in the United States in 2018 based on data from two phase III studies on reversing the anticoagulant activity of FXa inhibitors rivaroxaban and apixaban in healthy volunteers. As a condition of its accelerated approval, the ANNEXA-I study was conducted comparing it to other currently used reversal agents ("usual care"). Andexanet alfa was voluntarily withdrawn from the market by the manufacturer following safety concerns expressed by the FDA. Production and distribution was ended December 22, 2025.
Sources: en.wikipedia.org
Refrigeration is common for short-term use, while freezing at -20 °C or -80 °C is common for longer periods. Aliquots reduce repeated temperature changes. Exact conditions depend on the peptide and buffer.
Repeated freeze-thaw cycles can cause aggregation, precipitation, or adsorption losses. Dividing a solution into single-use portions limits those changes. The practice also makes handling more consistent.
Undissolved powder, aggregated peptide, or precipitated buffer salts can produce visible particles. Some particles appear only after freezing or pH changes. Filtration and analytical checks can help identify the source.
It is the process of dissolving a dried peptide preparation in a suitable liquid to obtain a solution. The liquid is often water, a buffer, or a water-organic mixture. The procedure is common in laboratory research and analytical work.